Review



her2 yfp plasmid 66948 plasmids  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Addgene inc her2 yfp plasmid 66948 plasmids
    Her2 Yfp Plasmid 66948 Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/her2+yfp+plasmid+66948+plasmids/pYFP-ErbB2+(Plasmid+%2366948)/10__1038_slash_nmat4893-263-6-13
    Average 86 stars, based on 1 article reviews
    her2 yfp plasmid 66948 plasmids - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: EGFR and HER2 activate rigidity sensing only on rigid matrices
    Article Snippet: Myosin-IIA transfected Cos-7 cells (Cos-7–IIA) were selected using fluorescence activated cell sorting (FACs) and cultured in Dulbecco’s modified Eagle’s medium (DMEM) high glucose supplemented with 10% FBS, 1mM sodium pyruvate (Invitrogen) and 250 μgml−1 selective antibiotics (G418) at 5% CO2 at 37 ◦C. .. EGFR-GFP (plasmid #32751), EGFR-Y1045F-GFP (plasmid #40267), HER2-YFP (plasmid #66948) plasmids were purchased from Addgene. .. The EGFR-Y845F and HER2-Y879F (Rat sequence, equal to Human sequence Y877) mutants were generated using primers 5′-AGAGAAAGAATTCCATGCAGAAGG AGG-3′ (EGFR), 5′-TCCGCACCCAGCAGTTG-3′ (EGFR), 5′-TGAGACAGAGT TCCATGCAGATG-3′ (HER2), 5′-TCAATGTCCAGCAGCCGA-3′ (HER2), following the protocol provided in Q5 Site-Directed Mutagenesis Kit (NEB).

    Article Title: EGFR and HER2 Activate Rigidity Sensing Only on Rigid Matrices
    Article Snippet: Myosin IIA transfected Cos7 cells (Cos7-IIA) were selected using fluorescence activated cell sorting (FACs) and cultured in Dulbecco’s modified Eagle’s medium (DMEM) high glucose supplemented with 10% FBS, 1 mM sodium pyruvate (Invitrogen) and 250 μg/ml selective antibiotics (G418) at 5% CO 2 at 37°C. .. EGFR-GFP (plasmid #32751), EGFR-Y1045F-GFP (plasmid #40267), HER2-YFP (plasmid #66948) plasmids were purchased from Addgene. .. The EGFR-Y845F and HER2-Y879F (Rat sequence, equal to Human sequence Y877) mutants were generated using primers 5′AGAGAAAGAATTCCATGCAGAAGGAGG3′ (EGFR), 5′TCCGCACCCAGCAGTTG-3′ (EGFR), 5′TGAGACAGAGTTCCATGCAGATG-3′ (HER2), 5′-TCAATGTCCAGCAGCCGA3′ (HER2), following the protocol provided in Q5 Site-Directed Mutagenesis Kit (NEB).



    Similar Products

    her2 yfp plasmid 66948 plasmids  (Addgene inc)
    86
    Addgene inc her2 yfp plasmid 66948 plasmids
    Her2 Yfp Plasmid 66948 Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/her2+yfp+plasmid+66948+plasmids/pYFP-ErbB2+(Plasmid+%2366948)/10__1038_slash_nmat4893-263-6-13
    Average 86 stars, based on 1 article reviews
    her2 yfp plasmid 66948 plasmids - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier

    Image Search Results